opti mem (Santa Cruz Biotechnology)
Santa Cruz Biotechnology is a verified supplier 
96
Structured Review
Santa Cruz Biotechnology
opti mem
Opti Mem, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1966 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transfection+medium/siRNA+Transfection+Reagent/pm41830491-154-29-20
Average 96 stars, based on 1966 article reviews
Opti Mem, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1966 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transfection+medium/siRNA+Transfection+Reagent/pm41830491-154-29-20
Average 96 stars, based on 1966 article reviews
opti mem - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Transfection:Article Title: Vertical RAS pathway inhibition in pancreatic cancer drives therapeutically exploitable mitochondrial alterations. Article Snippet: .. All siRNAs, the transfection reagent (sc-29528), and the Article Title: A predictive mechanochemical modeling framework for the deformation and remodeling of the nuclear lamina Article Snippet: .. To induce lamin A/C depletion, U2OS cells were transfected with lamin A/C siRNA (sc-35776, Santa Cruz Biotechnology) using the siRNA Transfection Reagent (sc-29528) and Article Title: Vertical RAS pathway inhibition in pancreatic cancer drives therapeutically exploitable mitochondrial alterations Article Snippet: .. All siRNAs, the transfection reagent (sc-29528), and the Article Title: Neuron-glioma synaptic transmission amplified by free 19S proteasome-mediated AMPAR deubiquitination promotes tumor progression. Article Snippet: .. In Tube A, 5 μL of siRNA was added to 100 μL of Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo Article Snippet: .. A truncated β - catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6 -mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and Article Title: Inflammatory Co-Regulation of Voltage-Gated Sodium Channels and Na,K-ATPase in Metastatic Breast Cancer Article Snippet: For Ringer’s experiments cells were washed in either Ringer’s buffer (Thermo Scientific, Waltham, MA, USA, AAJ67572AP) or sodium-free Ringer’s buffer (Thermo Scientific, AAJ67760AP), before being incubated in fresh Ringer’s buffer or sodium-free Ringer’s buffer for 30 min before adding experimental media. .. Article Title: Neuron-glioma synaptic transmission amplified by free 19S proteasome-mediated AMPAR deubiquitination promotes tumor progression Article Snippet: .. In Tube A, 5 μL of siRNA was added to 100 μL of Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo. Article Snippet: .. A truncated β-catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6-mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and CRISPR:Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo Article Snippet: .. A truncated β - catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6 -mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo. Article Snippet: .. A truncated β-catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6-mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and Mutagenesis:Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo Article Snippet: .. A truncated β - catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6 -mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and Article Title: Wnt/β-catenin signalling modulates the timing of cell fate decision making in the early mouse embryo. Article Snippet: .. A truncated β-catenin GATA6 inducible cell line was obtained by CRISPR mutation using ready-made plasmids from Santa Cruz (sc-419477) formed by three different gRNA (one: ATGAGCAGCGTCAAACTGCG; two: AGCTACTTGCTCTTGCGTGA; three: AAAATGGCAGTGCGCCTAGC). tet::Gata6-mCherry mESCs were transfected chemically using the transfection reagent (Santa Cruz, sc-395739) and |